ID: 1046905624_1046905627

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1046905624 1046905627
Species Human (GRCh38) Human (GRCh38)
Location 8:119569364-119569386 8:119569384-119569406
Sequence CCTCAGCCTGCACGGGAGTCAGA AGAGGCACTCAGCAATGCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157} {0: 1, 1: 0, 2: 2, 3: 13, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!