ID: 1047022626_1047022631

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1047022626 1047022631
Species Human (GRCh38) Human (GRCh38)
Location 8:120792222-120792244 8:120792265-120792287
Sequence CCATTATTCTAAGTGAAGTAACT CTGTATGTTCTCATAAGTGGGGG
Strand - +
Off-target summary {0: 1012, 1: 1316, 2: 1081, 3: 1412, 4: 2409} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!