ID: 1047036951_1047036957

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1047036951 1047036957
Species Human (GRCh38) Human (GRCh38)
Location 8:120950601-120950623 8:120950632-120950654
Sequence CCTCCTCCTCCCGGGTTTAAGTG GCCTCTGTCTCCCGAGTAGCTGG
Strand - +
Off-target summary No data {0: 28, 1: 3685, 2: 110189, 3: 273755, 4: 218047}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!