ID: 1047202883_1047202895

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1047202883 1047202895
Species Human (GRCh38) Human (GRCh38)
Location 8:122781503-122781525 8:122781534-122781556
Sequence CCTCCCCCCCAGCTCCTGCCTGA ATTTCGCCGGTGTCTCCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 106, 4: 1045} {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!