ID: 1047202884_1047202897

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1047202884 1047202897
Species Human (GRCh38) Human (GRCh38)
Location 8:122781506-122781528 8:122781536-122781558
Sequence CCCCCCCAGCTCCTGCCTGAAAA TTCGCCGGTGTCTCCGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 38, 4: 384} {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!