ID: 1047202885_1047202897

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1047202885 1047202897
Species Human (GRCh38) Human (GRCh38)
Location 8:122781507-122781529 8:122781536-122781558
Sequence CCCCCCAGCTCCTGCCTGAAAAA TTCGCCGGTGTCTCCGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 323} {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!