ID: 1047286757_1047286761

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1047286757 1047286761
Species Human (GRCh38) Human (GRCh38)
Location 8:123493872-123493894 8:123493909-123493931
Sequence CCATAAATGTTACACTGGGGCTG TGCCTGTAATCCTAGCACTTCGG
Strand - +
Off-target summary No data {0: 7892, 1: 107752, 2: 241468, 3: 240344, 4: 208055}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!