ID: 1047286757_1047286764

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1047286757 1047286764
Species Human (GRCh38) Human (GRCh38)
Location 8:123493872-123493894 8:123493913-123493935
Sequence CCATAAATGTTACACTGGGGCTG TGTAATCCTAGCACTTCGGGAGG
Strand - +
Off-target summary No data {0: 446, 1: 28088, 2: 322696, 3: 263272, 4: 201362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!