ID: 1047286757_1047286766

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1047286757 1047286766
Species Human (GRCh38) Human (GRCh38)
Location 8:123493872-123493894 8:123493922-123493944
Sequence CCATAAATGTTACACTGGGGCTG AGCACTTCGGGAGGCCAAGATGG
Strand - +
Off-target summary No data {0: 73, 1: 5182, 2: 69671, 3: 157107, 4: 157734}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!