ID: 1047325695_1047325700

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1047325695 1047325700
Species Human (GRCh38) Human (GRCh38)
Location 8:123833994-123834016 8:123834007-123834029
Sequence CCCATTCTTAGCCTCCCAAAATG TCCCAAAATGCTGGGATTACAGG
Strand - +
Off-target summary No data {0: 13221, 1: 306476, 2: 262600, 3: 198956, 4: 220194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!