ID: 1047343992_1047343995

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1047343992 1047343995
Species Human (GRCh38) Human (GRCh38)
Location 8:124009703-124009725 8:124009723-124009745
Sequence CCAGGAAGGAGCTGGTGCTGCTG CTGTTCTAGGGTGAGAGTTGAGG
Strand - +
Off-target summary {0: 3, 1: 6, 2: 40, 3: 137, 4: 701} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!