ID: 1047355653_1047355663

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1047355653 1047355663
Species Human (GRCh38) Human (GRCh38)
Location 8:124119285-124119307 8:124119334-124119356
Sequence CCTGAGGCTGTCAGGAAAGACTT CAGGTTGGACAGATGGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 250} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!