ID: 1047614852_1047614856

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1047614852 1047614856
Species Human (GRCh38) Human (GRCh38)
Location 8:126555960-126555982 8:126555997-126556019
Sequence CCATACACAGCTCAGCTCCGCCA CTTTCGTGCTGGTCCCGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153} {0: 1, 1: 0, 2: 0, 3: 6, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!