ID: 1047614854_1047614862

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1047614854 1047614862
Species Human (GRCh38) Human (GRCh38)
Location 8:126555980-126556002 8:126556032-126556054
Sequence CCAAAGCAGACAAGCAGCTTTCG CCCACTCTGGCCTTTCTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97} {0: 1, 1: 0, 2: 4, 3: 21, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!