ID: 1047638032_1047638042

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1047638032 1047638042
Species Human (GRCh38) Human (GRCh38)
Location 8:126787443-126787465 8:126787470-126787492
Sequence CCCCACAGAGCTGATCATCCCAT CATGGGAGGACACAGAGAGAAGG
Strand - +
Off-target summary No data {0: 4, 1: 66, 2: 479, 3: 1517, 4: 3120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!