ID: 1047642418_1047642422

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1047642418 1047642422
Species Human (GRCh38) Human (GRCh38)
Location 8:126834623-126834645 8:126834651-126834673
Sequence CCAGTTCCGGGCCGGGTACGGTG CACCTGTAATCCCAACACTTTGG
Strand - +
Off-target summary No data {0: 5278, 1: 86308, 2: 220449, 3: 250032, 4: 194863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!