ID: 1047642418_1047642424

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1047642418 1047642424
Species Human (GRCh38) Human (GRCh38)
Location 8:126834623-126834645 8:126834655-126834677
Sequence CCAGTTCCGGGCCGGGTACGGTG TGTAATCCCAACACTTTGGTTGG
Strand - +
Off-target summary No data {0: 142, 1: 23394, 2: 327621, 3: 259821, 4: 135609}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!