ID: 1047642420_1047642422

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1047642420 1047642422
Species Human (GRCh38) Human (GRCh38)
Location 8:126834629-126834651 8:126834651-126834673
Sequence CCGGGCCGGGTACGGTGGCTCAC CACCTGTAATCCCAACACTTTGG
Strand - +
Off-target summary {0: 19, 1: 821, 2: 4761, 3: 10505, 4: 12492} {0: 5278, 1: 86308, 2: 220449, 3: 250032, 4: 194863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!