ID: 1047722106_1047722112

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1047722106 1047722112
Species Human (GRCh38) Human (GRCh38)
Location 8:127650583-127650605 8:127650623-127650645
Sequence CCTGGGCATACTGGCAAGATCCC TTACAAAAATTAGCTGGGCATGG
Strand - +
Off-target summary No data {0: 310, 1: 24186, 2: 55936, 3: 107509, 4: 137092}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!