ID: 1047722106_1047722113

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1047722106 1047722113
Species Human (GRCh38) Human (GRCh38)
Location 8:127650583-127650605 8:127650626-127650648
Sequence CCTGGGCATACTGGCAAGATCCC CAAAAATTAGCTGGGCATGGTGG
Strand - +
Off-target summary No data {0: 22180, 1: 66270, 2: 133935, 3: 178969, 4: 181051}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!