ID: 1047739988_1047739997

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1047739988 1047739997
Species Human (GRCh38) Human (GRCh38)
Location 8:127798598-127798620 8:127798629-127798651
Sequence CCCGTAATCCCAGCACTTTGGGA CCGGTAGATTACCTGAGGTCAGG
Strand - +
Off-target summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!