ID: 1048206732_1048206742

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1048206732 1048206742
Species Human (GRCh38) Human (GRCh38)
Location 8:132421529-132421551 8:132421564-132421586
Sequence CCTAGGGTGTGTGGGTCGGGGGA ATTCACTTGGGGCAGATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!