ID: 1048247047_1048247051

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1048247047 1048247051
Species Human (GRCh38) Human (GRCh38)
Location 8:132816960-132816982 8:132816973-132816995
Sequence CCACCTTACCCATGCCTGATGAT GCCTGATGATTCTGTAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137} {0: 1, 1: 1, 2: 6, 3: 39, 4: 781}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!