ID: 1048307434_1048307437

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1048307434 1048307437
Species Human (GRCh38) Human (GRCh38)
Location 8:133294167-133294189 8:133294197-133294219
Sequence CCAACATGTTGTCATGGAAAAAA GCTCTGAAGTCCAACTGTCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 23, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!