ID: 1048307434_1048307439

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1048307434 1048307439
Species Human (GRCh38) Human (GRCh38)
Location 8:133294167-133294189 8:133294209-133294231
Sequence CCAACATGTTGTCATGGAAAAAA AACTGTCCGGGTTCAAAGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!