ID: 1048558354_1048558369

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1048558354 1048558369
Species Human (GRCh38) Human (GRCh38)
Location 8:135505358-135505380 8:135505407-135505429
Sequence CCACTTCCCTGCCCTGCTTGTGG TTCAGGGCTAGCGTAGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 71, 4: 656} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!