ID: 1048558365_1048558369

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1048558365 1048558369
Species Human (GRCh38) Human (GRCh38)
Location 8:135505391-135505413 8:135505407-135505429
Sequence CCCTTGAGAGCTCTCCTTCAGGG TTCAGGGCTAGCGTAGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 274} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!