ID: 1048820738_1048820743

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1048820738 1048820743
Species Human (GRCh38) Human (GRCh38)
Location 8:138378396-138378418 8:138378411-138378433
Sequence CCTCAGTTTCCCCAACTGCAAGT CTGCAAGTTGCTTTGGAGTCTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 52, 3: 475, 4: 2752} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!