ID: 1048825046_1048825050

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1048825046 1048825050
Species Human (GRCh38) Human (GRCh38)
Location 8:138416148-138416170 8:138416165-138416187
Sequence CCCCCAGGACAAAATAAATCTTA ATCTTAATTCTCTGTACTTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!