ID: 1048957373_1048957379

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1048957373 1048957379
Species Human (GRCh38) Human (GRCh38)
Location 8:139548132-139548154 8:139548163-139548185
Sequence CCCCCAGAGTTCAATCGGCCCTT ATAATGCTCCATGCACTTGAAGG
Strand - +
Off-target summary No data {0: 7, 1: 28, 2: 40, 3: 30, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!