ID: 1048979656_1048979665

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1048979656 1048979665
Species Human (GRCh38) Human (GRCh38)
Location 8:139696588-139696610 8:139696619-139696641
Sequence CCGTCCAATAAGCAAGTGAGTTG CTGAGTACACAGAGGAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!