ID: 1049004823_1049004836

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1049004823 1049004836
Species Human (GRCh38) Human (GRCh38)
Location 8:139847909-139847931 8:139847948-139847970
Sequence CCACCAAAGCCTCCGCTCCCTGC CTGTGTCAGCAGCAGCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 399} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!