ID: 1049122846_1049122855

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1049122846 1049122855
Species Human (GRCh38) Human (GRCh38)
Location 8:140755417-140755439 8:140755454-140755476
Sequence CCCTCTACTCCGCGGCCACACCG TACTGTCCTGCCCCGCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!