ID: 1049161847_1049161853

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1049161847 1049161853
Species Human (GRCh38) Human (GRCh38)
Location 8:141103005-141103027 8:141103034-141103056
Sequence CCAGGCTTCTGCCCGGTGCCACT CCCCATGCCCCTTCCTGAAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 19, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!