ID: 1049187854_1049187860

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1049187854 1049187860
Species Human (GRCh38) Human (GRCh38)
Location 8:141268058-141268080 8:141268111-141268133
Sequence CCAAGACGTCCTTGTGTAGGTGA GAATGTCATTCACCGCTAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 267, 4: 717} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!