ID: 1049203316_1049203330

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1049203316 1049203330
Species Human (GRCh38) Human (GRCh38)
Location 8:141352126-141352148 8:141352144-141352166
Sequence CCCCCTCTCCCTGGCCCACAGCT CAGCTTTCTGGTGGGGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 118, 4: 924} {0: 1, 1: 0, 2: 1, 3: 14, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!