ID: 1049223166_1049223185

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1049223166 1049223185
Species Human (GRCh38) Human (GRCh38)
Location 8:141437016-141437038 8:141437062-141437084
Sequence CCCGCCATGGGGAGCTGTGGGTC GGGAGCTGTGGGTCCCGGCCTGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 207, 3: 3803, 4: 9266} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!