ID: 1049290424_1049290433

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1049290424 1049290433
Species Human (GRCh38) Human (GRCh38)
Location 8:141798683-141798705 8:141798718-141798740
Sequence CCCAGCCACTGTCACACGTCAGC CACTGTGTCCAGAGCTAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 16, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!