ID: 1049474591_1049474607

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1049474591 1049474607
Species Human (GRCh38) Human (GRCh38)
Location 8:142790815-142790837 8:142790861-142790883
Sequence CCAAGAGAAACAAACCTGTTCCC GGCGGGGCTGGCACCTTCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 34, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!