ID: 1049655249_1049655257

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1049655249 1049655257
Species Human (GRCh38) Human (GRCh38)
Location 8:143794335-143794357 8:143794361-143794383
Sequence CCCTGACTGCTGCCCCCATGACT CTGTTGTTCATGAGGATGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 25, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!