ID: 1049658957_1049658967

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1049658957 1049658967
Species Human (GRCh38) Human (GRCh38)
Location 8:143811246-143811268 8:143811282-143811304
Sequence CCACACAGCCCCCGATCTCGGGC GGTGGTTCCGGTCCACGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138} {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!