ID: 1049693254_1049693260

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1049693254 1049693260
Species Human (GRCh38) Human (GRCh38)
Location 8:143971935-143971957 8:143971970-143971992
Sequence CCAGGGATCTGTCTGGCTCACCC GAAGTAGTTCCCACCCCAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!