ID: 1049766210_1049766219

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1049766210 1049766219
Species Human (GRCh38) Human (GRCh38)
Location 8:144356435-144356457 8:144356470-144356492
Sequence CCAGGCAGAGCTCCTCTAGGCTA CCGGGAGCCACCCCTCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119} {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!