ID: 1049794749_1049794763

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1049794749 1049794763
Species Human (GRCh38) Human (GRCh38)
Location 8:144492036-144492058 8:144492080-144492102
Sequence CCCCAGAGCCAGCTGGAGGGCAG GGCCCCCAGAACCAGCCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 76, 4: 496} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!