ID: 1049844161_1049844170

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1049844161 1049844170
Species Human (GRCh38) Human (GRCh38)
Location 8:144792099-144792121 8:144792124-144792146
Sequence CCTTCCTCTGTCCACGGATCACA GCCCATGGCGACGGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 175} {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!