ID: 1049844165_1049844172

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1049844165 1049844172
Species Human (GRCh38) Human (GRCh38)
Location 8:144792110-144792132 8:144792125-144792147
Sequence CCACGGATCACACGGCCCATGGC CCCATGGCGACGGGTCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55} {0: 1, 1: 0, 2: 2, 3: 9, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!