ID: 1049844171_1049844180

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1049844171 1049844180
Species Human (GRCh38) Human (GRCh38)
Location 8:144792125-144792147 8:144792158-144792180
Sequence CCCATGGCGACGGGTCCTGGGGG TTAGCGCGGCCGGGCGGCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83} {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!