ID: 1049844173_1049844183

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1049844173 1049844183
Species Human (GRCh38) Human (GRCh38)
Location 8:144792126-144792148 8:144792175-144792197
Sequence CCATGGCGACGGGTCCTGGGGGC CCCGGGTACCCCCGCCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 144} {0: 1, 1: 0, 2: 2, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!