ID: 1049877654_1049877664

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1049877654 1049877664
Species Human (GRCh38) Human (GRCh38)
Location 8:145036073-145036095 8:145036126-145036148
Sequence CCAATCAGCAGGACATGGGCAGG CAGCCAGCAGTGGCAACCTATGG
Strand - +
Off-target summary {0: 74, 1: 144, 2: 288, 3: 480, 4: 2176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!