ID: 1050014959_1050014966

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1050014959 1050014966
Species Human (GRCh38) Human (GRCh38)
Location 9:1223790-1223812 9:1223837-1223859
Sequence CCAAAGTGCTAGGATTACAGGCA AAGCCTTCTTAACCCAACCAAGG
Strand - +
Off-target summary {0: 7892, 1: 107752, 2: 241468, 3: 240344, 4: 208055} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!